Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzcR1 in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ0376
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR1 - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -77
Score: 6.3
Sequence: ATATATCGAATTTGGTATAC
Position: -40
Score: 6.1
Sequence: ATATTCCATTTTTGATATAT
Locus tag: LJ0376
Name: czcR1
Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
czcR1
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family

Position: -72
Score: 6.1
Sequence: ATATATCAAAAATGGAATAT
Position: -35
Score: 6.3
Sequence: GTATACCAAATTCGATATAT
Locus tag: LJ0377
Name: czcD
Funciton: Cobalt-zinc-cadmium resistance protein CzcD
czcD
Cobalt-zinc-cadmium resistance protein CzcD
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD