Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of UxuR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0145
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization; Galacturonate utilization
Effector:
Regulog: UxuR - Lactobacillaceae
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -119
Score: 6.7
Sequence: ATAGCTTATATATCAGTTTT
Locus tag: LVIS_0136
Name: uidB
Funciton: Predicted oligogalacturonide transporter
Locus tag: LVIS_0135
Name: uxaC
Funciton: Uronate isomerase (EC 5.3.1.12)
uidB
Predicted oligogalacturonide transporter
uxaC
Uronate isomerase (EC 5.3.1.12)

Position: -259
Score: 6.7
Sequence: AAAACTGATATATAAGCTAT
Locus tag: LVIS_0137
Name: aglX
Funciton: Alpha-glucosidase, predicted
Locus tag: LVIS_0138
Name: bglX
Funciton: Beta-galactosidase/glucuronidase
aglX
Alpha-glucosidase, predicted
bglX
Beta-galactosidase/glucuronidase

Position: -86
Score: 6.6
Sequence: AATACTGATATATAAGTTAT
Locus tag: LVIS_0139
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: LVIS_0140
Name: yqhA
Funciton: Predicted aldose epimerase
Locus tag: LVIS_0141
Name: pgmX
Funciton: Predicted phosphoglycerate mutase
Locus tag: LVIS_0142
Name: pgdH
Funciton: Predicted 3-phosphoglycerate dehydrogenase
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)
yqhA
Predicted aldose epimerase
pgmX
Predicted phosphoglycerate mutase
pgdH
Predicted 3-phosphoglycerate dehydrogenase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD