Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BusR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0356
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Betaine utilization
Effector: Betaine
Regulog: BusR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 7.7
Sequence: AGTGACAACCTATACTTTATAACAAGTTGTCTCT
Locus tag: LEUM_0356
Name: busR
Funciton: Betaine utilization transcriptional regulator BusR, GntR family
busR
Betaine utilization transcriptional regulator BusR, GntR family

Position: -146
Score: 7.7
Sequence: AGAGACAACTTGTTATAAAGTATAGGTTGTCACT
Locus tag: LEUM_0357
Name: busA
Funciton: Glycine betaine ABC transporter, ATP-binding protein
Locus tag: LEUM_0358
Name: busB
Funciton: Glycine betaine ABC transporter, substrate binding and permease protein
busA
Glycine betaine ABC transporter, ATP-binding protein
busB
Glycine betaine ABC transporter, substrate binding and permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD