Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YwzG in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type: Transcription factor
TF locus tag: LSL_0105
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: YwzG - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 6.9
Sequence: ATATTATATGATATATAATAT
Locus tag: LSL_0105
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LSL_0106
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LSL_0107
Name: lp_3218
Funciton: Conserved hypothetical protein
Locus tag: LSL_0108
Name: COG1983
Funciton: Putative stress-responsive transcriptional regulator
ywzG
Predicted transcriptional regulator, PadR family
lp_3217
Predicted integral membrane protein
lp_3218
Conserved hypothetical protein
COG1983
Putative stress-responsive transcriptional regulator
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD