Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YwzG in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0242
Regulator family: PadR
Regulation mode: repressor
Biological process: Transport
Effector:
Regulog: YwzG - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -36
Score: 7.1
Sequence: ATATTATACGTCGTATAGTAT
Locus tag: LVIS_0242
Name: ywzG
Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LVIS_0243
Name: lp_3217
Funciton: Predicted integral membrane protein
Locus tag: LVIS_0244
Name: lp_3218
Funciton: Conserved hypothetical protein
ywzG
Predicted transcriptional regulator, PadR family
lp_3217
Predicted integral membrane protein
lp_3218
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD