Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YtrA in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_02246
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Regulog: YtrA - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 6.7
Sequence: GTGTACTGCGTATAATAGTACAC
Locus tag: LGG_02246
Name: ytrA
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: LGG_02245
Name: ytrB
Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: LGG_02244
Name: lp_0327
Funciton: Predicted ABC transporter, permease protein
ytrA
Predicted transcriptional regulator, GntR family
ytrB
Predicted ABC transporter, ATP-binding protein
lp_0327
Predicted ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD