Regulon of YtrA in Lactobacillus plantarum WCFS1
| Regulator type: | Transcription factor |
| TF locus tag: | lp_0325, lp_1959 |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Regulog: | YtrA - Lactobacillaceae |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -49
Score: 6.3 Sequence: GTGTACTAGTTGTAGTAATACAC
Locus tag: lp_1959
Name: ytrA Funciton: Predicted transcriptional regulator, GntR family
Locus tag: lp_1958
Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein
Locus tag: lp_1957
Name: null Funciton: ABC transporter, permease protein
Locus tag: lp_1956
Name: null Funciton: ABC transporter, permease protein |
|||
|
ytrA
|
Predicted transcriptional regulator, GntR family
|
||
|
ytrB
|
Predicted ABC transporter, ATP-binding protein
|
||
|
ABC transporter, permease protein
|
|||
|
ABC transporter, permease protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |