Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YtrA in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Properties
Regulator type: Transcription factor
TF locus tag: LBUL_1589
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Regulog: YtrA - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -50
Score: 6.7
Sequence: GTGTACTAGAATAAATAGTACAG
Locus tag: LBUL_1589
Name: ytrA
Funciton: Predicted transcriptional regulator, GntR family
Locus tag: LBUL_1588
Name: ytrB
Funciton: Predicted ABC transporter, ATP-binding protein
ytrA
Predicted transcriptional regulator, GntR family
ytrB
Predicted ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD