Regulon of YtrA in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Regulator type: | Transcription factor |
TF locus tag: | LBUL_1589 |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Hypothetical ABC transporter |
Effector: | |
Regulog: | YtrA - Lactobacillaceae |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
Locus Tag | Name | Function | |
---|---|---|---|
Position: -50
Score: 6.7 Sequence: GTGTACTAGAATAAATAGTACAG
Locus tag: LBUL_1589
Name: ytrA Funciton: Predicted transcriptional regulator, GntR family
Locus tag: LBUL_1588
Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein |
|||
ytrA
|
Predicted transcriptional regulator, GntR family
|
||
ytrB
|
Predicted ABC transporter, ATP-binding protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |