Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Lp_2742 in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_1308
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 6.7
Sequence: TTAGTTACACAAGTAATTAA
Locus tag: PEPE_1743
Name: lp_2739
Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
Locus tag: PEPE_1744
Name: lp_2740
Funciton: Predicted antimicrobial peptide ABC transporter, permease protein
lp_2739
Predicted antimicrobial peptide ABC transporter, ATP-binding protein
lp_2740
Predicted antimicrobial peptide ABC transporter, permease protein

Position: -61
Score: 6.3
Sequence: TTAGTTACATGACTAATTAA
Locus tag: PEPE_1308
Name: lp_2742
Funciton: Transcriptional regulator, GntR family
Locus tag: PEPE_1307
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: PEPE_1306
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Locus tag: PEPE_1305
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
lp_2742
Transcriptional regulator, GntR family
lp_2743
ABC-type multidrug transport system, ATPase component
lp_2744
ABC-type multidrug transport system, permease component
lp_2744
ABC-type multidrug transport system, permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD