Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Lp_2742 in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type: Transcription factor
TF locus tag: LSL_1617
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 6.8
Sequence: TTAGTTACATAAGTAATTAA
Locus tag: LSL_1617
Name: lp_2742
Funciton: Transcriptional regulator, GntR family
Locus tag: LSL_1616
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: LSL_1615
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
lp_2742
Transcriptional regulator, GntR family
lp_2743
ABC-type multidrug transport system, ATPase component
lp_2744
ABC-type multidrug transport system, permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD