Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Lp_2742 in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0389
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 6.7
Sequence: TTAATTACACAAGTAACTAA
Locus tag: LVIS_0387
Name: lp_2739
Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
Locus tag: LVIS_0388
Name: lp_2740
Funciton: Predicted antimicrobial peptide ABC transporter, permease protein
Locus tag: LVIS_0389
Name: lp_2742
Funciton: Transcriptional regulator, GntR family
lp_2739
Predicted antimicrobial peptide ABC transporter, ATP-binding protein
lp_2740
Predicted antimicrobial peptide ABC transporter, permease protein
lp_2742
Transcriptional regulator, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD