Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MtlR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type: Transcription factor
TF locus tag: LSL_1628
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: HPr, phosphocarrier protein; MtlA, mannitol-specific enzyme IICB PTS component
Regulog: MtlR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -110
Score: 6.9
Sequence: TTTGACACTGACAACTGTGCCAAA
Locus tag: LSL_1620
Name: mtlA
Funciton: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Locus tag: LSL_1619
Name: mtlF
Funciton: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
Locus tag: LSL_1618
Name: mtlD
Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
mtlA
PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
mtlF
PTS system, mannitol-specific IIA component (EC 2.7.1.69)
mtlD
Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD