Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0929
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -83
Score: 6.8
Sequence: TTTCCGCAAGTATGAGGAAA
Locus tag: LEUM_0927
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: LEUM_0928
Name: celB
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: LEUM_0929
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: LEUM_0930
Name: celA
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: LEUM_0931
Name: LEUM_0931
Funciton: Conserved hypothetical protein
Locus tag: LEUM_0932
Name: celD
Funciton: Cellobiose-specific PTS, component EIIC
bglA
6-phospho-beta-glucosidase (EC 3.2.1.86)
celB
Cellobiose-specific PTS, component EIIB
celR
Cellobiose utilization transcriptional regulator CelR, BglG family
celA
Cellobiose-specific PTS, component EIIA
LEUM_0931
Conserved hypothetical protein
celD
Cellobiose-specific PTS, component EIIC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD