Regulon of CcpN in Oenococcus oeni PSU-1
| Regulator type: | Transcription factor |
| TF locus tag: | OEOE_1329 |
| Regulator family: | CcpN |
| Regulation mode: | repressor |
| Biological process: | Gluconeogenesis |
| Effector: | |
| Regulog: | CcpN - Lactobacillaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - CcpN
- By pathway - Gluconeogenesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -144
Score: 4.4 Sequence: TAATTATGTTTAATAAAAAAA
Locus tag: OEOE_1329
Name: ccpN Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|||
|
ccpN
|
Gluconeogenesis transcriptional regulator CcpN, CcpN family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |