Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CcpN in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type: Transcription factor
TF locus tag: LSA1142
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -138
Score: 5.4
Sequence: ATATAGTGTGTCACATTACAA
Locus tag: LSA1142
Name: ccpN
Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family
Locus tag: LSA1143
Name: yqfL
Funciton: Predicted phosphotransferase
ccpN
Gluconeogenesis transcriptional regulator CcpN, CcpN family
yqfL
Predicted phosphotransferase

Position: -55
Score: 5.4
Sequence: TTGTAATGTGACACACTATAT
Locus tag: LSA1141
Name: ppdK
Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
ppdK
Pyruvate phosphate dikinase (EC 2.7.9.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD