Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CcpN in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_02352
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Lactobacillaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -66
Score: 4.7
Sequence: CTGCTAAATAATACATTATAT
Locus tag: LGG_02351
Name: ppdK
Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
ppdK
Pyruvate phosphate dikinase (EC 2.7.9.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD