Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LJ1265 in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ1265
Regulator family: LacI
Regulation mode: repressor
Biological process: Pentose utilization
Effector:
Regulog: LJ1265 - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 6.6
Sequence: TTTTGTAAGCATTTACAAGA
Locus tag: LJ1266
Name: LJ1266
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: LJ1267
Name: LJ1267
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
Locus tag: LJ1268
Name: LJ1268
Funciton: Predicted pentose kinase
LJ1266
Transketolase, N-terminal section (EC 2.2.1.1)
LJ1267
Transketolase, C-terminal section (EC 2.2.1.1)
LJ1268
Predicted pentose kinase

Position: -108
Score: 6.6
Sequence: TCTTGTAAATGCTTACAAAA
Locus tag: LJ1265
Name: LJ1265
Funciton: Predicted pentose utilization transcriptional regulator, LacI family
Locus tag: LJ1264
Name: LJ1264
Funciton: Predicted pentose isomerase, TM0951
Locus tag: LJ1263
Name: LJ1263
Funciton: Conserved hypothetical protein
LJ1265
Predicted pentose utilization transcriptional regulator, LacI family
LJ1264
Predicted pentose isomerase, TM0951
LJ1263
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD