Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LJ1265 in Lactobacillus acidophilus NCFM

Properties
Regulator type: Transcription factor
TF locus tag: LBA1488
Regulator family: LacI
Regulation mode: repressor
Biological process: Pentose utilization
Effector:
Regulog: LJ1265 - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 6.4
Sequence: TTTTGTAAGCAATTACAAGT
Locus tag: LBA1489
Name: LJ1266
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: LBA1490
Name: LJ1267
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
Locus tag: LBA1492
Name: LJ1268
Funciton: Predicted pentose kinase
LJ1266
Transketolase, N-terminal section (EC 2.2.1.1)
LJ1267
Transketolase, C-terminal section (EC 2.2.1.1)
LJ1268
Predicted pentose kinase

Position: -103
Score: 6.4
Sequence: ACTTGTAATTGCTTACAAAA
Locus tag: LBA1488
Name: LJ1265
Funciton: Predicted pentose utilization transcriptional regulator, LacI family
LJ1265
Predicted pentose utilization transcriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD