Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LSEI_0368 in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_00419
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: LSEI_0368 - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -141
Score: 6.5
Sequence: GTGCGAAAACGTTTACACAA
Position: -43
Score: 6.7
Sequence: TTGCGTAAACGTTACCGCAA
Locus tag: LGG_00418
Name: tal
Funciton: Transaldolase (EC 2.2.1.2)
Locus tag: LGG_00417
Name: LSEI_0366
Funciton: Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS
Locus tag: LGG_00416
Name: LGG_00416
Funciton: Predicted PTS, EIIA component
Locus tag: LGG_00415
Name: LGG_00415
Funciton: Predicted PTS, EIIB component
tal
Transaldolase (EC 2.2.1.2)
LSEI_0366
Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS
LGG_00416
Predicted PTS, EIIA component
LGG_00415
Predicted PTS, EIIB component

Position: -180
Score: 6.7
Sequence: TTGCGGTAACGTTTACGCAA
Position: -82
Score: 6.5
Sequence: TTGTGTAAACGTTTTCGCAC
Locus tag: LGG_00419
Name: LSEI_0368
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
LSEI_0368
Predicted sugar utilization transcriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD