Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR3 in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_0083
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR3 - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -115
Score: 5
Sequence: AAAAGTAAACGGTTGCTAAT
Locus tag: LAR_1508
Name: malT2
Funciton: Predicted maltose/maltodextrin permease
Locus tag: LAR_1507
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
malT2
Predicted maltose/maltodextrin permease
nplT
Neopullulanase (EC 3.2.1.135)

Position: -69
Score: 6.1
Sequence: TTAAGTAAACGTTTACATTA
Locus tag: LAR_0078
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: LAR_0079
Name: malT2
Funciton: Predicted maltose/maltodextrin permease
nplT
Neopullulanase (EC 3.2.1.135)
malT2
Predicted maltose/maltodextrin permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD