Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR3 in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_3531, lp_3625
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR3 - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 5.5
Sequence: TAATGTAATCGTTTACATAA
Locus tag: lp_2757
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
nplT
Neopullulanase (EC 3.2.1.135)

Position: -115
Score: 5.8
Sequence: TAACGTAAACGTTTACAATA
Position: -83
Score: 5.5
Sequence: TAAAGTAAACGTTTACACTT
Locus tag: lp_3531
Name: malR3
Funciton: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
malR3
Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family

Position: -106
Score: 5.5
Sequence: AAGTGTAAACGTTTACTTTA
Position: -74
Score: 5.8
Sequence: TATTGTAAACGTTTACGTTA
Locus tag: lp_3533
Name: malT2
Funciton: Predicted maltose/maltodextrin permease
Locus tag: lp_3534
Name: agl
Funciton: Alpha-glucosidase (EC 3.2.1.20)
malT2
Predicted maltose/maltodextrin permease
agl
Alpha-glucosidase (EC 3.2.1.20)

Position: -52
Score: 6.3
Sequence: TTAAGCAAACGTTTGCTTAA
Locus tag: lp_3627
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: lp_3626
Name: malT2
Funciton: Predicted maltose/maltodextrin permease
Locus tag: lp_3625
Name: malR3
Funciton: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
nplT
Neopullulanase (EC 3.2.1.135)
malT2
Predicted maltose/maltodextrin permease
malR3
Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD