Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0892
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -203
Score: 6.3
Sequence: TAATGTTATCGTTAACATTG
Locus tag: LEUM_0994
Name: malT
Funciton: Predicted maltose/maltodextrin permease
Locus tag: LEUM_0995
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
Locus tag: LEUM_0996
Name: galM
Funciton: Aldose 1-epimerase
Locus tag: LEUM_0997
Name: pgcM
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malT
Predicted maltose/maltodextrin permease
malK
Maltose phosphorylase (EC 2.4.1.8)
galM
Aldose 1-epimerase
pgcM
Beta-phosphoglucomutase (EC 5.4.2.6)

Position: -104
Score: 6.1
Sequence: TGATGTTACCGTTAACATCG
Locus tag: LEUM_0893
Name: malT
Funciton: Predicted maltose/maltodextrin permease
Locus tag: LEUM_0894
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
Locus tag: LEUM_0895
Name: pgcM
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malT
Predicted maltose/maltodextrin permease
malK
Maltose phosphorylase (EC 2.4.1.8)
pgcM
Beta-phosphoglucomutase (EC 5.4.2.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD