Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_0173
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 5.8
Sequence: TAATGTAATCGTTTACATAA
Locus tag: lp_2757
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
nplT
Neopullulanase (EC 3.2.1.135)

Position: -103
Score: 6.3
Sequence: TTCTGTTAACGTTAACATTA
Locus tag: lp_0175
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: lp_0176
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: lp_0177
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: lp_0178
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX
Maltose/maltodextrin ABC transporter, substrate-binding protein
malC
Maltose/maltodextrin ABC transporter, permease protein 1
malD
Maltose/maltodextrin ABC transporter, permease protein 2
malA
Maltodextrose utilization protein MalA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD