Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ0210
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -81
Score: 5.5
Sequence: TTTTGATACCGGTAACAGAT
Locus tag: LJ0211
Name: malL
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
Locus tag: LJ0212
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
malL
Oligo-1,6-glucosidase (EC 3.2.1.10)
nplT
Neopullulanase (EC 3.2.1.135)

Position: -100
Score: 6.1
Sequence: TTTTGATACCGGTAACATTA
Locus tag: LJ0213
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
Locus tag: LJ0214
Name: pgcM
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malK
Maltose phosphorylase (EC 2.4.1.8)
pgcM
Beta-phosphoglucomutase (EC 5.4.2.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD