Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Lactobacillus helveticus DPC 4571

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -63
Score: 5.6
Sequence: TTTTGATACCGGTAACATCC
Locus tag: lhv_2002
Name: malL
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
Locus tag: lhv_2001
Name: nplT
Funciton: Neopullulanase (EC 3.2.1.135)
malL
Oligo-1,6-glucosidase (EC 3.2.1.10)
nplT
Neopullulanase (EC 3.2.1.135)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD