Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_0979
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 5.4
Sequence: TTTTGATAACGGTAACAAAC
Locus tag: LSEI_0980
Name: malL
Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
malL
Oligo-1,6-glucosidase (EC 3.2.1.10)

Position: -129
Score: 5.8
Sequence: TTATGATAGCGGTAACATTC
Locus tag: LSEI_0982
Name: malK
Funciton: Maltose phosphorylase (EC 2.4.1.8)
Locus tag: LSEI_0983
Name: pgcM
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
malK
Maltose phosphorylase (EC 2.4.1.8)
pgcM
Beta-phosphoglucomutase (EC 5.4.2.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD