Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NigR in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ0744
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Regulog: NigR - Lactobacillaceae
Statistics of regulated genes:
- Genes 12
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -101
Score: 6.9
Sequence: AACTTAAAACGTTTCAAGTT
Position: -35
Score: 5
Sequence: TATTTAAAACGTTTAGATTT
Locus tag: LJ0739
Name: nigB
Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: LJ0740
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LJ0741
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LJ0742
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LJ0743
Name: ogl
Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LJ0744
Name: nigR
Funciton: Nigerose utilization repressor, LacI family
nigB
Nigerose-specific PTS system, EIIB component
nigC
Nigerose-specific PTS system, EIIC component
nigD
Nigerose-specific PTS system, EIID component
nigA
Nigerose-specific PTS system, EIIA component
ogl
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
nigR
Nigerose utilization repressor, LacI family

Position: -101
Score: 6.9
Sequence: AACTTAAAACGTTTCAAGTT
Locus tag: LJ0739
Name: nigB
Funciton: Nigerose -specific PTS system, EIIB component
Locus tag: LJ0740
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LJ0741
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LJ0742
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LJ0743
Name: ogl
Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LJ0744
Name: nigR
Funciton: Nigerose utilization regulator, LacI family
nigB
Nigerose -specific PTS system, EIIB component
nigC
Nigerose-specific PTS system, EIIC component
nigD
Nigerose-specific PTS system, EIID component
nigA
Nigerose-specific PTS system, EIIA component
ogl
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
nigR
Nigerose utilization regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD