Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BfrR in Lactobacillus acidophilus NCFM

Properties
Regulator type: Transcription factor
TF locus tag: LBA0500
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 6.4
Sequence: AAATTGAAACGTTTCAAAAG
Locus tag: LBA0502
Name: bfrE
Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: LBA0503
Name: bfrF
Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: LBA0504
Name: bfrG
Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: LBA0505
Name: bfrA
Funciton: Beta-fructosidases (EC 3.2.1.26)
Locus tag: LBA0506
Name: bfrH
Funciton: Fructooligosaccharides ABC transporter, ATP-binding protein
Locus tag: LBA0507
Name: bfrP
Funciton: Predicted fructooligosaccharides phosphorylase
bfrE
Fructooligosaccharides ABC transporter, substrate-binding protein
bfrF
Fructooligosaccharides ABC transporter, permease protein 1
bfrG
Fructooligosaccharides ABC transporter, permease protein 2
bfrA
Beta-fructosidases (EC 3.2.1.26)
bfrH
Fructooligosaccharides ABC transporter, ATP-binding protein
bfrP
Predicted fructooligosaccharides phosphorylase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD