Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Lp_3221 in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_02106
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Lp_3221 - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 6.5
Sequence: ATATGGAATCGATACCACAT
Locus tag: LGG_02105
Name: agl4
Funciton: Oligo-1,6-glucosidase
Locus tag: LGG_02104
Name: scrT
Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
Locus tag: LGG_02103
Name: scrT
Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
agl4
Oligo-1,6-glucosidase
scrT
PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
scrT
PTS system, sucrose-specific IIABC component (EC 2.7.1.69)

Position: -38
Score: 6.3
Sequence: GTATGAAATCGATTCCATAA
Locus tag: LGG_02106
Name: lp_3221
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
lp_3221
Predicted sugar utilization transcriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD