Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Lp_3221 in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_3221
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Lp_3221 - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 6.4
Sequence: AAGTGGAATCGATTCCAAAT
Locus tag: lp_3220
Name: agl4
Funciton: Oligo-1,6-glucosidase
Locus tag: lp_3219
Name: scrT
Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
agl4
Oligo-1,6-glucosidase
scrT
PTS system, sucrose-specific IIABC component (EC 2.7.1.69)

Position: -36
Score: 6.2
Sequence: TTATGGAAACGATTCCAAAC
Locus tag: lp_3221
Name: lp_3221
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
lp_3221
Predicted sugar utilization transcriptional regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD