Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Rcas_3562 in Roseiflexus sp. RS-1

Properties
Regulator type: Transcription factor
TF locus tag: RoseRS_1355
Regulator family: GntR/Others
Regulation mode:
Biological process: Alpha-galactosides utilization
Effector:
Regulog: Rcas_3562 - Chloroflexia
Statistics of regulated genes:
- Genes 8
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -47
Score: 7.1
Sequence: TGTCCTGCATCCTATGCAATAAGACA
Locus tag: RoseRS_1355
Name: Rcas_3562
Funciton: Transcriptional regulator, GntR family
Locus tag: RoseRS_1356
Name: galZ
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: RoseRS_1357
Name: abcP
Funciton: sugar ABC transporter, permease protein
Locus tag: RoseRS_1358
Name: abcT
Funciton: sugar ABC transporter, permease 2
Locus tag: RoseRS_1359
Name: abcB
Funciton: sugar ABC transport system, sugar-binding protein
Locus tag: RoseRS_1360
Name: galY
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: RoseRS_1361
Name: Rcas_3568
Funciton: hypothetical protein
Locus tag: RoseRS_1362
Name: Rcas_3569
Funciton: Putative oxidoreductase
Rcas_3562
Transcriptional regulator, GntR family
galZ
Alpha-galactosidase (EC 3.2.1.22)
abcP
sugar ABC transporter, permease protein
abcT
sugar ABC transporter, permease 2
abcB
sugar ABC transport system, sugar-binding protein
galY
Alpha-galactosidase (EC 3.2.1.22)
Rcas_3568
hypothetical protein
Rcas_3569
Putative oxidoreductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD