Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Cagg_1084 in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_3103
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog: Cagg_1084 - Chloroflexia
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 6.9
Sequence: AAACATCAGATCATCAGATGAAT
Locus tag: Chy400_3102
Name: COG0730
Funciton: predicted transporter
COG0730
predicted transporter

Position: -37
Score: 7.3
Sequence: AAACATCAGATGATATGATCTTT
Locus tag: Chy400_3103
Name: Cagg_1084
Funciton: Transcriptional regulator, GntR family
Cagg_1084
Transcriptional regulator, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD