Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HcpR in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_2668, Cagg_2027
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: HcpR - Chloroflexia
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -86
Score: 6.8
Sequence: AAGTTGCGCTAGCGCAACGT
Locus tag: Cagg_2669
Name: Rcas_3898
Funciton: Cytochrome c family protein involved in nitrosative stress
Locus tag: Cagg_2670
Name: Rcas_3899
Funciton: hypothetical protein involved in nitrosative stress
Rcas_3898
Cytochrome c family protein involved in nitrosative stress
Rcas_3899
hypothetical protein involved in nitrosative stress

Position: -116
Score: 6.5
Sequence: ATCTTGCGCTAGCGCAACGA
Locus tag: Cagg_2026
Name: Rcas_3898
Funciton: Cytochrome c family protein involved in nitrosative stress
Locus tag: Cagg_2025
Name: Rcas_3899
Funciton: hypothetical protein involved in nitrosative stress
Rcas_3898
Cytochrome c family protein involved in nitrosative stress
Rcas_3899
hypothetical protein involved in nitrosative stress
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD