Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0802
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -65
Score: 6.1
Sequence: TAAATAGTAATAATTACTATAAT
Position: -43
Score: 6.7
Sequence: TTAAAAGTAATTGTTACTATTTA
Locus tag: LEUM_0082
Name: lp_0947
Funciton: Conserved hypothetical protein
lp_0947
Conserved hypothetical protein

Position: -171
Score: 6.2
Sequence: TTTAAAGTAATCATTACTTTTTG
Position: -142
Score: 6.2
Sequence: TTAATAGTAATGATTACTATAAT
Locus tag: LEUM_0803
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: LEUM_0804
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: LEUM_0805
Name: znuB
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuC
Zinc ABC transporter, ATP-binding protein
znuB
Zinc ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD