Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_1528
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -9
Score: 5.3
Sequence: TAAAAAGTAATGTTAACTTTAAG
Locus tag: LAR_0209
Name: znuB
Funciton: Zinc ABC transporter, permease protein
znuB
Zinc ABC transporter, permease protein

Position: -36
Score: 6.8
Sequence: TAAATAGTAACGATTACGATTAA
Locus tag: LAR_0207
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: LAR_0208
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein
znuA
Zinc ABC transporter, substrate-binding protein
znuC
Zinc ABC transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD