Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Lactobacillus fermentum IFO 3956

Properties
Regulator type: Transcription factor
TF locus tag: LAF_1665
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 6.7
Sequence: TTAATCGTAAGGATTACGATTTA
Locus tag: LAF_0191
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: LAF_0192
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: LAF_0193
Name: znuB
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuC
Zinc ABC transporter, ATP-binding protein
znuB
Zinc ABC transporter, permease protein

Position: -37
Score: 5.8
Sequence: AAAAACGTAATCATTACTAAAAA
Locus tag: LAF_1665
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -82
Score: 6.5
Sequence: TAAATGGTAATAATTACTATTTG
Locus tag: LAF_1127
Name: rpsN2
Funciton: Small subunit ribosomal protein S14, zinc-independent
rpsN2
Small subunit ribosomal protein S14, zinc-independent
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD