Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_2025
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 6.5
Sequence: TTAATCGTAATCAATACGATTTA
Locus tag: LSEI_2025
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -183
Score: 7
Sequence: TAATTCGTAATCATTACTATTTA
Position: -40
Score: 6.7
Sequence: TAAATCGTAATTATTACGTTTTG
Locus tag: LSEI_2427
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
znuA
Zinc ABC transporter, substrate-binding protein

Position: -248
Score: 6.9
Sequence: TAAATAGTAATGATTACGAATTA
Locus tag: LSEI_2425
Name: rpsN2
Funciton: Small subunit ribosomal protein S14, zinc-independent
rpsN2
Small subunit ribosomal protein S14, zinc-independent

Position: -183
Score: 6.4
Sequence: CAAAACGTAATAATTACGATTTA
Position: -40
Score: 6.9
Sequence: TAAATAGTAATGATTACGAATTA
Locus tag: LSEI_2426
Name: lp_0947
Funciton: Conserved hypothetical protein
lp_0947
Conserved hypothetical protein

Position: -39
Score: 6.4
Sequence: TAAACCGTAATCGTTACCGTTTA
Locus tag: LSEI_0242
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: LSEI_0243
Name: znuB
Funciton: Zinc ABC transporter, permease protein
znuC
Zinc ABC transporter, ATP-binding protein
znuB
Zinc ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD