Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_1778
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -37
Score: 5.9
Sequence: TAAAGCGTAATAATTACTATCAA
Locus tag: LVIS_0360
Name: rpsN2
Funciton: Small subunit ribosomal protein S14, zinc-independent
rpsN2
Small subunit ribosomal protein S14, zinc-independent

Position: -46
Score: 6.6
Sequence: TAAACGGTAATCATTACTGTTTA
Locus tag: LVIS_0470
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
Locus tag: LVIS_0471
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein
Locus tag: LVIS_0472
Name: znuB
Funciton: Zinc ABC transporter, permease protein
znuA
Zinc ABC transporter, substrate-binding protein
znuC
Zinc ABC transporter, ATP-binding protein
znuB
Zinc ABC transporter, permease protein

Position: -41
Score: 6.8
Sequence: TAAATAGTAATAATTACCATTTA
Locus tag: LVIS_0566
Name: znuA
Funciton: Zinc ABC transporter, substrate-binding protein
znuA
Zinc ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD