Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_0894
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 6.4
Sequence: TTAGCACTCCAACTTTCTAAGTGCTAA
Locus tag: PEPE_0894
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: PEPE_0895
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: PEPE_0896
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: PEPE_0897
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -65
Score: 6.3
Sequence: TTAGCACTTAGAGATGACGAGTGCTAA
Locus tag: PEPE_0420
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: PEPE_0421
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -122
Score: 6.9
Sequence: TTAGCACTTTACTTAACAGAGTGCTAA
Locus tag: PEPE_0976
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
clpC
ATP-dependent Clp protease ATP-binding subunit ClpA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD