Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_1349
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -110
Score: 7.4
Sequence: TTGGCACTCTTATAAAAAGAGTGCTAA
Position: -41
Score: 6.3
Sequence: TTAGCAGTTAGATATAGTGAGTGCTAA
Locus tag: LEUM_1349
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LEUM_1348
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LEUM_1347
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LEUM_1346
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -54
Score: 7.5
Sequence: TTAGCACTCACGTTTAAAGAGTGCTAA
Locus tag: LEUM_1763
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LEUM_1762
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -81
Score: 6.4
Sequence: TTAGCACTCTCGTCTCTAATGTGCTAA
Locus tag: LEUM_0396
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -151
Score: 7.6
Sequence: TTAGCACTCTACTTTAAAGAGTGCTAA
Locus tag: LEUM_0571
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD