Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type: Transcription factor
TF locus tag: LSA1238
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -96
Score: 7.7
Sequence: TTAGCACTCGTGATAAAAGAGTGCTAA
Locus tag: LSA0050
Name: hsp
Funciton: Small heat shock protein
hsp
Small heat shock protein

Position: -121
Score: 5.9
Sequence: GTGGCACTTTTCTTGCTAGAGTGCTAA
Locus tag: LSA0207
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
clpC
ATP-dependent Clp protease ATP-binding subunit ClpA

Position: -41
Score: 7
Sequence: TTAGCACTCGTAATAATCAAGTGCTAA
Locus tag: LSA1238
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LSA1237
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LSA1236
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LSA1235
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -55
Score: 6.8
Sequence: TTAGCACTTGAGTGTTTAGAGTGCTAA
Locus tag: LSA0358
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LSA0359
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD