Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_2029
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -191
Score: 7.1
Sequence: TTAGCACTCGTAAGTAAGGAGTGCTAA
Position: -36
Score: 6.7
Sequence: TTAGCACTCCATTAAGTTAAGTGCTAA
Locus tag: lp_2029
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: lp_2028
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: lp_2027
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: lp_2026
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -51
Score: 6.4
Sequence: TTAGCACTTGAGGTTGAGGAGTGCTAA
Locus tag: lp_0727
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: lp_0728
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -149
Score: 7.5
Sequence: TTAGCACTCGAGTTAAACGAGTGCTAA
Locus tag: lp_0129
Name: hsp
Funciton: Small heat shock protein
hsp
Small heat shock protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD