Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ1481
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -91
Score: 6.4
Sequence: TTAGCACTCTACTTGAACAATTGCTAA
Position: -43
Score: 6.3
Sequence: TTAGCACAGAAGAAAGAAGAGTGCTAA
Locus tag: LJ1481
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LJ1480
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LJ1479
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LJ1478
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -70
Score: 7.6
Sequence: TTAGCACTCATATATCAAGAGTGCTAA
Locus tag: LJ0815
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit

Position: -155
Score: 6.9
Sequence: TTAGCACTCTGATGATAAAAGTGCTAA
Position: -70
Score: 7
Sequence: TTAGCACTTATAATATATGAGTGCTAA
Locus tag: LJ0460
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LJ0461
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -58
Score: 6.7
Sequence: TTAGCACTTATAACTTATGAGTGCTAA
Locus tag: LJ1775
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
clpC
ATP-dependent Clp protease ATP-binding subunit ClpA

Position: -78
Score: 5.9
Sequence: TTAGCACCGTTCTAATTAGTGTGCTAA
Locus tag: LJ0181
Name: hsp
Funciton: Small heat shock protein
hsp
Small heat shock protein

Position: -49
Score: 6.9
Sequence: TTAGCACTGTACTTATTAGAGTGCTAA
Locus tag: LJ0869
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD