Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Lactobacillus helveticus DPC 4571

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 6.7
Sequence: TTAGCACTTGACTACTAAGAGTGCTAA
Locus tag: lhv_0683
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit

Position: -59
Score: 5.9
Sequence: TTAGCACTTGAAGGCTTTAAGTGCTAA
Locus tag: lhv_2043
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpA
clpC
ATP-dependent Clp protease ATP-binding subunit ClpA

Position: -130
Score: 6.1
Sequence: TTAGCACTATATGCTTTTGAATGCTAA
Locus tag: lhv_0222
Name: hsp
Funciton: Small heat shock protein
hsp
Small heat shock protein

Position: -60
Score: 6.6
Sequence: TTAGCACAGTACTTAAAAGAGTGCTAA
Locus tag: lhv_0735
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -159
Score: 6.9
Sequence: TTAGCACTATTTGTAAAAAAGTGCTAA
Position: -85
Score: 7.1
Sequence: TTAGCACTTAAGAAATAAGAGTGCTAA
Locus tag: lhv_0425
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: lhv_0426
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD