Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YybA in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ0661
Regulator family: MarR
Regulation mode:
Biological process: unknown
Effector:
Regulog: YybA - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 7.8
Sequence: TTATTGTCGCATTTGCAACAATAA
Locus tag: LJ0661
Name: yybA
Funciton: Predicted transcriptional regulator, MarR family
Locus tag: LJ0662
Name: LBA1664
Funciton: Protease synthase and sporulation negative regulatory protein PAI 1
yybA
Predicted transcriptional regulator, MarR family
LBA1664
Protease synthase and sporulation negative regulatory protein PAI 1
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD