Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TreR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag: PEPE_1805
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Regulog: TreR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -171
Score: 5.8
Sequence: TAACTAGTATATACAAGGTA
Position: -95
Score: 6.1
Sequence: CATCTTGTATATACAAGTTT
Locus tag: PEPE_1804
Name: treP
Funciton: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
treP
Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Position: -142
Score: 6.2
Sequence: AAACTTGTATATACAAGATG
Position: -66
Score: 5.7
Sequence: TACCTTGTATATACTAGTTA
Locus tag: PEPE_1805
Name: treR
Funciton: Trehalose utilization transcriptional repressor TreR, GntR family
Locus tag: PEPE_1806
Name: treA
Funciton: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
treR
Trehalose utilization transcriptional repressor TreR, GntR family
treA
Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD