Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Oenococcus oeni PSU-1

Properties
Regulator type: Transcription factor
TF locus tag: OEOE_0146
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -47
Score: 5.1
Sequence: TGTTGTAAACGTTTTAAGAA
Locus tag: OEOE_0146
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsR
Transcriptional repressor of ribose utilization, LacI family

Position: 25
Score: 6.4
Sequence: TTAGTAAAGCGTTTTACTTA
Locus tag: OEOE_1612
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: OEOE_1613
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: OEOE_1614
Name: rbsP
Funciton: Predicted ribose permease
rbsK
Ribokinase (EC 2.7.1.15)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsP
Predicted ribose permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD