Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type: Transcription factor
TF locus tag: LSA0203
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 6.9
Sequence: TTAGTAAAACGTTTTACTAA
Locus tag: LSA0200
Name: rbsU
Funciton: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
Locus tag: LSA0201
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: LSA0202
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: LSA0203
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsU
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsK
Ribokinase (EC 2.7.1.15)
rbsR
Transcriptional repressor of ribose utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD