Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_1219
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -35
Score: 4.7
Sequence: TAGATAAAACTGTTTACTAA
Locus tag: LAR_1219
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: LAR_1218
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsR
Transcriptional repressor of ribose utilization, LacI family
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD