Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_1422
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 5.2
Sequence: GATGTAAAACGTTTTACGAT
Locus tag: LVIS_1588
Name: rbsP
Funciton: Predicted ribose permease
rbsP
Predicted ribose permease

Position: -125
Score: 5
Sequence: TAAGTAAATCGATTTACGCA
Locus tag: LVIS_1589
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsD
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)

Position: -50
Score: 6.5
Sequence: TACGTAAAACGTTTTACAAA
Locus tag: LVIS_1421
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
rbsK
Ribokinase (EC 2.7.1.15)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD